Micropia transposable element occurrence in Drosophila species of the saltans group.

Almeida, L.M., J.P. Castro, and C.M.A. Carareto.  Departamento de Biologia – IBILCE – UNESP. Rua Cristóvão Colombo 2265 CEP 15054-000, São José do Rio Preto – SP, Brasil;  email:  carareto@bio.ibilce.unesp.br

Introduction

Transposable elements origin and distribution in different species and whether they are recent or old components of the host genome are still subjects of research.  The presence of a transposable element in all organisms of a species group suggests that they are old components of these genomes.  Members of the retrotransposon family micropia were discovered as constituents of wild-type Y chromosomal fertility genes from Drosophila hydei (Hennig et al., 1983;  Huijser et al., 1988), but they also occur in autosomes and X chromosomes.  The presence of the micropia retrotransposon in different Drosophila species was determined by Southern analysis using the micropia element of D. hydei as a probe.  It has been found in several species of the all subgroups of the repleta group, but with patchy distribution (Lankenau et al., 1994); in the immigrans group, in D. immigrans, in the funebris group, in D. funebris, and in the mellanica group, in D. mellanica (Lankenau, 1993); and in three of the four species groups of the subgenus Sophophora: melanogaster group (D. melanogaster, D. simulans, D. birchii, D. yakuba, D. ananassae);  willistoni group (D. willistoni); and the saltans group (D. saltans) (Lankenau and Hennig, 1990;  Lankenau et al., 1988;  Lankenau et al., 1990;  Lankenau et al., 1994).  Micropia has been studied in details only in species of the repleta group, D. hydei in special, and in D. melanogaster.  It has a typical retrotransposon structure with approximately 5.5 kb length and a 4 kb open reading frame encoding putative products that show homology to the nucleocapsid, protease, reverse transcriptase, RNase H and integrase products of vertebrate retroviruses (Lankenau et al., 1988;  Lankenau et al., 1989).  The general structure of this retrotransposon is well conserved in both species, but the LTRs are completely different.  The overall sequence homology ranges between 70% and 90% on the amino acid level.  Micropia encodes a 5.0 kb transcript that is expressed in both testes and somatic tissues of males and females. Although the great similarity, micropia in D. hydei produces an antisense RNA overlapping the RNaseH and parts of the transcriptase reverse that is not expressed in D. melanogaster.  Since only D. saltans was screened for the presence of micropia in its genome, this study aimed to contribute to the knowledge about micropia distribution in the saltans species group.  

Material and Methods

Species:  The species of D. saltans group studied are listed in Table 1.

PCR reactions:  PCR reactions were performed in 25ml volumes using approximately 200ng of template DNA, 100 mM of each dNTP, 12 pmol of each primer, 1.5 mM of MgCl2 and 1 unit of Taq DNA Polymerase (GIBCO-BRL) in 1´ Polymerase Buffer.  After an initial denaturation for 3 min at 95°C, 40 cycles consisting of a 1-min denaturation at 95 °C, a 1-min annealing at 52°C and a 2-min extension at 72°C steps were followed.  An additional extension step of 10 min at 72°C was performed after the last cycle.  The amplified fragments were separated by electrophoresis in a 1% agarose gel.  The primers used were #2813 (5’- TTAACTCCTAGAGTTCATCGCTGG- 3’) and #2814 (5’- CATGTACCTGGTTAACTACTGACC - 3’) which amplify a 386 bp fragment from a highly conserved sequence of micropia (from nucleotide 2813 to 3198).

Dot blot hybridization: Denaturated DNA (5 mg) was applied directly to the nylon membrane and hybridized with a 3.1 kb micropia fragment excised with EcoRI from dhMiF₂ plasmid (Huijser et al., 1988).  Hybridization and detection were performed with ECL^TM direct nucleic acid labeling and detection systems according to manufacturer’s instructions.

Figure 1.  Dot blot of D. saltans species group probed with a 3.1 kb micropia fragment.  The genomic DNAs were blotted as follow: 1. D. neocordata; 2. D. emarginata; 3. D. parasaltans; 4. D. subsaltans; 5. D. milleri; 6. D. dacunhai; 7. D. sturtevanti; 8. D. austrosaltans; 9. D. saltans; 10. D. prosaltans; 11. micropia (dhMiF₂ plasmid).

Results and Discussion

Table 1.  Species of saltans group of Drosophila used in this study. Subgroup Species Geographic Origin Collection       neocordata D. neocordata Minas Gerais-Brazil Stock Center n. 14041-0831.0       elliptica D. emarginata Vera Cruz- Mexico Stock Center n. 14042-0841.6       parasaltans D. parasaltans D. subsaltans Tapuruquara- Bazil Belém-Brazil Bicudo, H.E.M.C.-UNESP Stock Center n. 14044-0872.0       sturtevanti D. milleri D. dacunhai D. sturtevanti Puerto Rico Haiti Matlapa- Mexico Stock Center n. 1403-0861.0 Stock Center n. 1403-0854.0 Silva, J - University of Arizona       saltans D. austrosaltans D. saltans D. prosaltans Pirassununga-Brazil Chilpancingo-Mexico Trinidad Tobago Bicudo, H.E.M.C.- UNESP Bicudo, H.E.M.C.- UNESP Bicudo, H.E.M.C.- UNESP

Micropia retrotransposon occurs in D. saltans as reported by Lankenau et al. (1988), Lankenau and Hennig (1990), Lankenau et al., (1990), Lankenau et al. (1994), and Biémont and Cizeron (1999), in their revision about the distribution of transposable elements in Drosophila species.  As the occurrence of micropia has not been reported for other species of the saltans group, we have searched for its occurrence in 10 species, one at least belonging to each saltans species subgroups (cordata, elliptica, parasaltans, sturtevanti and saltans).  All the species possess this retrotransposon in their genomes (Figures 1 and 2).  These results reinforce the hypothesis of micropia’s wide distribution in Drosophila genera (Lankenau et al., 1994), suggesting that this element may be an old genome component possibly introduced in Drosophila genera before its diversification.  Although it has a wide distribution, it appears that there are two groups of micropia elements in Drosophila species.  One group, represented by micropia from D. melanogaster, does not possess the testis-specific antisense promoter, whereas the other group, represented by D. hydei elements, expresses such RNA in primary spermatocytes.  So far, from six species tested that contain copies of micropia five also express the 1.0 kb antisense RNA;  all these five species belong to the of repleta group (Lankenau et al., 1994).

Figure 2.  PCR amplification of micropia internal sequence from D. saltans species group and control DNAs.  1. negative control; 2. D. neocordata; 3. D. emarginata; 4. D. parasaltans; 5. D. subsaltans; 6. D. milleri; 7. D. dacunhai; 8. D. sturtevanti; 9. D. austrosaltans; 10. D. saltans; 11. D. prosaltans; 12. D. simulans; 13. D. melanogaster; 14. micropia (dhMiF₂ plasmid). L = 1 kb plus DNA ladder.

We here present a contribution to the knowledge of the distribution of micropia retrotransposon in the saltans group species.  According to literature, this is the first description of micropia occurrence in species of the subgroups cordata (

D. neocordata), elliptica (D. emarginata), sturtevanti (D. milleri, D. dacunhai, D. sturtevanti), and parasaltans (D. parasaltans and  D. subsaltans,) and in other species of the saltans subgroup than D. saltans (D. austrosaltans and D. prosaltans).  Since the saltans group belongs to the Sophophora subgenus, additional analyses are in progress in our laboratory aiming to determine whether the antisense RNA has still been transcribed in these species, or not, as in D. melanogater, a species closer to saltans than to repleta species group.

         Acknowledgments:  We thank D-H. Lankenau (German Cancer Research Center, Heidelberg, Germany) for providing us with dhMiF₂ plasmid.  This research was supported by grants and fellowships of FAPESP and CNPq.

            References:  Biémont, C., and G. Cizeron 1999, Genetica 105: 43-62;  Hennig W., P. Huijser, P. Vogt, H. Jäckle, and J-E. Edström 1983, EMBO J. 2: 1741-1746;  Huijser, P., C. Kirchhoff, D-H. Lankenau, and W. Hennig 1988, J. Mol. Biol. 203: 689-697;  Lankenau, D-H., 1993, In: Transposable Elements and Evolution. (McDonald, J., ed.). pp. 232-241.  Kluwer, Dordrecht, The Netherlands;  Lankenau, D-H., and W. Hennig 1990, Nucl. Acids Res. 18: 4265-4266; Lankenau, D-H., P. Huijser, E. Jansen, K. Miedema, and W. Hennig 1988, J. Mol. Biol. 204: 233-246;  Lankenau, D-H., P. Huijser, W. Hennig 1989, J. Mol. Biol. 209: 493-497;  Lankenau, D-H., P. Huijser, E. Jansen, K. Miedema, and W. Hennig 1990, Chromosoma 99: 111-117;  Lankenau, S., V.G. Corces, and D-H. Lankenau 1994, Mol. Cell. Biol. 14: 1764-1775.