Scott's Botanical Links--September 2005

----------

Home Page

Past links:

September 30, 2005 - JGI Eukaryotic Genomics
The DOE's Joint Genome Institute (JGI) is dedicated to sequencing entire genones of several dozen carefully selected nucleated organisms representing major groups in the tree of life, including a number of green organisms (unicelled algae to angiosperms). To obtain a full idea of the scope, go to "Coming Soon" and then click on "Why Sequence Them". The list of organismal models is fascinating, representing essentially all major phyla at least once. Techniques and protocols, sequences, meetings and progress reports are posted. Completed projects have annotated sequences and molecular tools available, from software to collections. Site by JGI. (***1/2) -SR
September 29, 2005 - PISCO: Marine Algal Taxonomic Database
PISCO is an acronym for Partnership for Interdisciplinary Studies of Coastal Oceans. As part of their project they have constructed an elaborate web site devoted to their mission, research projects, consulting and outreach. This central part of the site catalogs major marine algae, synonyms, descriptions and digitized images for access on the web. To use this, you need to know genera and species. Accessible from the home page though is their new 'Short Attention Span Theater'--brief online movies covering marine biology topics. Site by the PISCO consortium of scientists from Oregon State University, Stanford, UC-Santa Barbara and UC-Santa Cruz. (***1/2) -SR
September 28, 2005 - Crop Production by Hydroponics
Hydroponics is a soil-less form of plant propagation that takes plants back to their elemental needs plus water, with great popularity as it simplifies many aspects of plant care. This site's pages cover a wide breadth of topics, mostly at an advanced beginning level. These include an introduction, history, concepts page, followed by techniques, hydroponic culture and systems, formulation of nutrient solutions, role of greenhouses, suitable crops for hydroponics, commercial production and future directions. This site is by Dr. Mallick F. Rahman, who is a consultant, formally head of the Hydroponics Lab at Ngee Ann Polytechnic, Singapore. (***1/2) -SR
September 27, 2005 - Autumn Foliage Changes
Late September marks the start of autumn and the beginning of color changes in deciduous leaves. This Harvard Forest site explores the topic thoroughly, providing documentation on intensely colored leaves. Photo galleries of leaves and plants that undergo color change are shown, as well as the science behind the color change. Static and time lapse images of New England landscapes display the progression, which is just at its start there. The site has a wealth of information about autumn leaf changes, as well as factors affecting color. Site by Dr. John O’Keefe, Coordinator of the Fisher Museum, Harvard Forest and Dr. David Lee, Biological Sciences, Florida International University. (****) -SR
September 26, 2005 - Wild Plants of Malta
Wild Plants of Malta is a sophisticated web site devoted to the ecology, geography, vegetation and flora of the Mediterranean islands comprising Malta. Currently there are summaries for members of 18 families, with detailed nomenclatural information, descriptions, Maltese common names, botanical data, photos and further information. The site is very well organized and richly illustrated, but there is still a tremendous amount of work remaining, as documented by the webmaster. This is a nice model for a small national flora site. This site was constructed, researched and photographed by Stephen Mifsud on Malta. (****) -SR
September 23, 2005 - Microbiological Garden
Microbiological-garden.net is a virtual garden of microbial images and information. The site has 30 galleries representing various bacterial groups, communities and environments on the home page that expand into detailed textual information and multiple images in each gallery. Photosynthetic organisms on the site include Euglena, phytoplankton and diatoms, as well as tidal flat communities and other environments. This project is hosted by the Institute for Chemistry and Biology of the Marine Environment (ICBM) at the University of Oldenburg, Germany, available in German and English. (****) -SR
September 22, 2005 - Understanding Evolution - your one-stop choice for information on evolution
The University of California Museum of Paleontology has created this dynamic site on evolution. With newspaper-style format, the site contains living examples of selection that underscore the predictive value of evolutionary theory, for example antibiotic resistance in bacteria, selection in everyday life and modern thought about the relationships of all organisms. It is an excellent resource for "K-16 teachers, with lesson plans, nuts-and-bolts knowledge, classroom strategies and more." Without using evolution ideas, response to disease spread and epidemics would be severely impaired. This is not a site of belief or non-belief but science. (****) -SR
September 21, 2005 - USDA National Nutrient Database
The USDA National Nutrient Database is a remarkably complete nutrition database on food composition of fruits, vegetables, nuts, grains and other foods from plants and animals, including many processed foods. The heart of the site is a very easy to use search engine that ultimately reveals a spectrum of nutrients: proximates (water, sugar types, proteins, carbohydrates, lipids), minerals, vitamins, lipids, amino acids and others by user-selected portion sizes. This site gives a very complete picture of nutrition, perhaps not unexpected for an over 110-year effort! Nominated by David R. Hershey. (****)
September 20, 2005 - ITALIC - The Information System on Italian Lichens
"ITALIC is an information system on Italian lichens searchable on line, which organizes information from four main databases: a) general checklist of Italian lichens, b) morpho-anatomical database, c) herbaria, d) regional checklists, and from two archives: a) iconographic archive, b) archive of predictive distributional maps." This site requires free registration and a password, but is so nicely organized that it is worth it. Each species is well described and illustrated -- a nice model for a systematics site. There is also a useful glossary. (****) -SR
September 19, 2005 - Australian Native Foods
Australian Native Foods is a site on native plants that: (1) have had aboriginal uses and (2) could be modified to produce commercial fruit or crops. Some of the crops most likely to become commercially prominent are: Acacias, bush tomatoes, citrus, Davidson plums, Illawarra plums, Lemon Aspen, Lemon Myrtle, Mountain Pepper, Muntries, Quandong, and Riberries. For each plant there is much information on many of the advantages and concerns of each crop. This site is by CSIRO Australia. Most of these crops seem to be a number of years away. (***1/2) -S
September 16, 2005 - Eduardo Kac - KAC WEB
Eduardo Kac is an artist who uses genetic transformation to create art forms, and juxtaposes unlikely partners in dialog, often involving plants! His most famous work so far is the GFP Bunny, Alba, who is perhaps the first artwork to have a living relationship with her artist. His most recent work is Move 36--a reference to Kasparov's lost match to Deep Blue, in which Kasparov saw "deep intelligence and creativity" in the machine's moves and unexpected subtlety, whereas Kasparov's moves were unexpectedly mechanical. A centerpiece of the work is a transformed plant in which Descartes' famous phrase "Cogito ergo sum" (I think therefore I am) is encoded into DNA bases and inserted upstream of a mutation for leaf curl, so that curled leaves carry the encrypted phrase in their DNA as CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC. A theme of subtlety that Kac himself may not know is that the "CAAT box", which initiates this DNA phrase is known by molecular biologists as a common promoter motif that is involved in initiating transcription for many genes across all kingdoms and organisms. Interesting and challenging site for the 21st century. (****) -SR
September 15, 2005 - Bush Tucker Plants (Australian Native Food Plants)
Bush Tucker for purposes of this website include foods native to aboriginal peoples and were present before European colonization of Australia. This site focuses on about 15 native plants, providing information, images, plant descriptions, usages and sometimes recipes. Since aboriginal people tended not to cook these, the native recipes could be quite spartan, but now these natives tend to be used for jams, chutney and jellies, spices, drinks, sauces, and dyes. This is an interesting an attractive ethnobotanical site that may be useful in complementing classroom activities. (***1/2) -SR
September 14, 2005 - Plant-Hormones.Info
The plant hormones website was initiated as an electronic forum to strengthen the community of plant-hormone scientists. The site contains information pages on the nature, history, biosynthesis, metabolism and functional activities of the traditional plant hormones, including abscisic acid, auxins, cytokinins, ethylene, and gibberellins. A listserv provides about seven years of archives of discussions of synthesis, extraction, purification, analysis, enzymology, molecular biology, hormone action and many other topics. This provides a succinct reference for traditional plant hormones. (***) -SR
September 13, 2005 - Foraging With the "Wildman"
Foraging is a natural activity with eons of history, but for civilized humans, it has to be relearned. "Foraging With the Wildman" is a tutorial site with help for those who would like to enjoy nature in a more tactile way. Some information about foraging is included, along with a lot of links to books (foraging to cooking), t-shirts, memorabilia and speaking opportunities. Once asked by the city to present a class on foraging in Central Park, he was arrested when he bit into a dandelion while he was making a point. Listing himself as Naturalist-Author-Broadcaster-Artist, he certainly lives up to all of these and his name as well. He has helped to ensure that foraging cannot be ignored. (***1/2) -SR
September 12, 2005 - Vertical Farm
Continuing population growth, combined with increasing urbanization and decline of suitable arable land has lead to a novel idea of meeting food demands--vertical farming. This site and its accompanying essay present a model for one model for developing sustainable agriculture. Vertical Farm is a visionary web site containing plans for this new mode of farming and precedents for its workability. This site by Dr. Despommier of Columbia University presents some challenges. As with any such revolutionary plan, analysis of the ideas in this site might be a nice model for critical reading as we move solidly into the 21st century. -SR
September 9, 2005 - Plant Biology for Non-science Majors (UMD BIOSCI 124)
This website accompanies the introductory plant biology course for non-majors at the University of Maryland. Interestingly, as the course has been offered a number of times since the site was created, there are different lectures on similar topics by multiple instructors. The links to lecture notes are a detailed outline of the material presented in class, with study suggestions, a model plant project, and additional materials, as instructors prefer. This seems not to be a bad place to start for a non-majors course. (***) -SR
September 8, 2005 - Biological Identity of Procaryotes
This page is a useful one page introduction for prokaryotes, which are bacterial cells that lack nuclei. Derivatives of prokaryotes became mitochondria and chloroplasts through endosymbiosis. Evidence of the interrelationships of these cells and organelles are presented at this website. This site includes information about their structure, biology, systematics and evolution at an advanced undergraduate level for a botany class (introductory for a microbiology course, however. Page and site by Kenneth Todar University of Wisconsin-Madison Department of Bacteriology. (****) -SR
September 7, 2005 - Lesson Planet: Lesson Plans for Botany
Lesson Planet boasts itself as the largest repository of K-12 lesson plan site links in the world and lists 69 lessons under the word "botany", but it does come at a bit of a price. Sites are directly accessed by silver (~$10) or gold (~$25) members; a bronze membership provides access to the top three sites and a biweekly newsletter. Featured web pages list the title of the site, and grade level of the exercise, along with a short description (which means sites could be googled). This appears to be a very useful site in supporting education, although there are others that are free. (***1/2) -SR
September 6, 2005 - Leaf ID 101
Noting that "Today's students are so busy that they do not stop and view what is in their environment", Kathy Gann of Stephens High School, Stephens, Arkansas, organized this web page on leaves. Accompanying this are lesson plans and worksheets that should provide some practical ideas on how to help students to focus on this task. The site currently also features bark identification of five common Arkansas trees. This is a nice model for others who may like to construct such a page for their school. -SR
September 2, 2005 - Biology at the Open Door Web Site
The Open Door Biology Web Site is designed for use by students and teachers at the sixth to eighth grade level. The list of topics approximates a beginning biology textbook, ranging from how organisms gather food and live, to reproduction, ecology and the environment. Topics rich in animal content tend to be at the top of the list and plant contents towards the bottom, but the plant coverage is still reasonably complete, even if it is mostly text. This site by The Open Door Team, a group of teachers from different schools internationally. (***) -SR
September 1, 2005 - Natural Products - The Chemicals that Shaped the World
Medicinal plants have provided countless examples of biologically active chemicals that humans have used since their origin. Part of a biology module at York University, this site offers a perspective on plant and chemical diversity at a sophisticated level, with full lectures and assessments. The coverage is ambitious and reasonably complete, presenting this information from a more theoretical perspective than many courses of its kind. This could be a useful site for ethnobotany as well as evolution of secondary plant products. The course is based on 9 lectures given by Richard Firn. (***1/2) -SR
----------

Past, past links (by date):

2006: January
2005: January, February, March, April, May, June, July, August, September, October, November, December
2003: January, February, March, April, May, June, July, August, September, October, November, December
2002: January, February, March, April, May, June, July, August, September, October, November, December
2001: January, February, March, April, May, June, July, August, September, October, November, December
2000: January, February, March, April, May, June, July, August, September, October, November, December
1999: January, February, March, April, May, June, July, August, September, October, November, December
1998: January*, February*, March*, April*, May*, June*, July, August, September, October, November, December   (*Leigh's links)
1997: January, February, March, April, May, June, September*, October*, November*, December*    (*Leigh's links)
1996: February, March, April, May, June, July, August, September, October, November, December
Or search by: Subject Index

----------

http://www.ou.edu/cas/botany-micro/bot-linx/sep05.shtml